SOLUTION: Transcription, Translation and Protein Structure.

True/False: Messenger RNA is transcribed by RNA polymerase II from a DNA template.
True/False: During transcription, mRNA is synthesized 5’à
True/False: As mRNA is synthesized, RNA nucleotides are added by base pairing with the complementary DNA strand; the sequence matches the coding (“top” or 5’) strand in the DNA double helix.
True/False: Messenger RNA is capped at the 3’ end, and a poly A tail added at the 5’ end, to make a mature mRNA.
True/False: mRNA is translated in the cytoplasm by ribosomes into a polypeptide chain.
True/False: Translation begins when a ribosome binds mRNA at the cap, scans down the mRNA nucleotides, and initiates when it reaches an AUG, encoding a Methionine (Met, M) amino acid.
True/False: Ribosomes are complex multi-subunit RNA and protein structures.
True/False: There are 20 amino acids, each encoded in mRNA by only one codon and by exactly one tRNA.
True/False: Mutations in a gene’s nucleotide (DNA) sequence always result in changes to the amino acids in a protein.
True/False: Alpha helix domains in the 3D protein structure of cyclin D1 are involved in interactions with CDK4 and DNA.
True/False: This algorithm will identify the start codon in a mRNA sequence: #My_Start_codon_finding_algorithm

>Read input (DNA) sequence 3 nt at a time

>If not AUG, go on to next 3 nt

>If AUG, print position in nucleotide sequence

>Advance +1 nt

>Repeat until no more sequence.

True/False: RT-PCR is a quantitative method for analyzing the amount of transcription of a specific gene.
True/False: A codon in a gene sequence encoding Threonine (Thr) is ACT. A mutation in the DNA changes the codon to ACG. The resulting protein structure will also change.
True/False: The degree of similarity between two DNA sequences can be analyzed by sequence alignment algorithms.
True/False: Translation takes place in the nucleus, while transcription takes place in the cytoplasm of the cell.
True/False: DNA replication occurs during S phase of the eukaryotic cell cycle.

(20pts.) Transcription and Translation: Assume a transcriptional activator binds the DNA at the response element (RE: GGGAATTCCC) of the immune system gene IL2. mRNA transcription goes 5’à3’ from the CATATA a motif where RNA pol II can bind for transcription to proceed. It stops at a poly-A signal (AATAAA) sequence and adds several hundred A.

IL2 DNA:

AATGGGAATTCCCGATCATATATGATGGTCCTGCATAAGTTGGTCCGTTCAAGTATGCATAGAGCCGCCCATTACCAAGTACGCATAATGGACTGTAAGTAATAAAC

In the IL2 gene sequence, identify the response element (RE) where the transcriptional activator protein binds, the TATA motif where RNA pol II binds, and the poly-A signal sequence.

Transcribe the IL2 DNA sequence into RNA beginning at CATATA motif. Add locations of 5’ cap and 3’ poly-A tail (just write a few AAA…).

Find an ORF in the mRNA (identify the translation start and stop codons in the sequence).

List the amino acids by group:
1. Polar:
2. Non-polar:
3. (+) charge:
4. (-) charge:

A patient with severe disease (a virus infection) has no functional IL2 protein. DNA sequencing shows the patient has a mutant IL2

Mutant IL2 DNA:

AATGGGAATTCCCGATCATATAGGAGGGTCCTGCATAAGTTGGTCCGTTCAAGTATGCATAGAGCCGCCCATTACCAAGTACGCATAATGGACTGTAAGTAATAAAC

Briefly explain why this patient does not synthesize IL2 protein, resulting in a compromised immune response to the virus:

Transcription, Translation and Protein Structure.

BIOLOGY A108 CQ 4

The post Transcription, Translation and Protein Structure. appeared first on Apax Researchers.