Assignment 20 – Transcription and Translation Think of this as a cumulative
Assignment 20 – Transcription and Translation
Think of this as a cumulative assignment showing me what you know and understand about Replication, Transcription and Translation. Please make sure you read it all thoroughly. Some instructions and assumptions have changed. You need to work through this carefully. Show all of your work. (20 points)
DNA Replication.
Below is a section of single-stranded DNA. We will call this the normal allele or wild-type allele.
5’–TTGCCAAATGGAATTCCTCAAATTTGGGCCCCAGGTAAGTTAGCACAGCTTTGAGCTGCAGGCCATACTACCGTAAGAT–3’
If this piece of DNA were to be a template during DNA replication, what would the resulting double-stranded DNA look like? Replicate it properly and show all important components of both DNA strands. Type it out so you do not make a mistake and I can read it.
At the 3’ end of all DNA and RNA there is a functional chemical group. What is its significance to DNA replication?
In a cell, many enzymes work in an ordered way to make DNA replication possible. One enzyme in particular would be needed to replicate this piece of DNA in the cell. It is the same process that is provided by us supplying primers when PCR is performed. What is the enzyme? Explain the role of the enzyme in the cell and how it does its job.
One allele of DNA that is found in the population has a mutation in one G nucleotide (bold above). In this allele, the G has been mutated to a C in the strand that is written above. Type the double-strand piece of DNA that would be responsible for this allele. Type it out so you do not make a mistake and I can read it. We will call this allele G to C allele.
A third allele that is found in the population has the G nucleotide (bold above) deleted. It is totally missing, but all of the rest of the DNA is present. Type the double-strand piece of DNA that would be responsible for this allele. Type it out so you do not make a mistake and I can read it. We will call this allele G allele.
Transcription.
You will be working with all three of the different alleles that you created above; wild-type (normal), G to C, and G. All three alleles use the top DNA strand as their coding strand. There is no promoter, so just start transcribing from the beginning of the correct strand. Type the RNA that results with the 5’ at the left of the paper.
Provide the primary transcript that results from the wild-type allele. Type it out so you do not make a mistake and I can read it.
Provide the primary transcript that results from the G to C allele. Type it out so you do not make a mistake and I can read it.
Provide the primary transcript that results from the G allele. Type it out so you do not make a mistake and I can read it.
What enzyme is responsible for creating these primary transcripts? Briefly describe how this enzyme works in the cell.
In question #3 above there is a requirement for a functional chemical group at the 3’ to initiate DNA Replication. Does initiation of transcription require the same functional chemical group? Explain.
mRNA Processing.
You will be working with all three of the primary transcripts that you created above; wild-type (normal), G to C, and G. Splicing of the primary transcript is one modification required to make mature mRNA in eukaryotes. Type the mRNA that results with the 5’ at the left of the paper.
Splicing enzymes recognize the 5’ end of introns that have the following sequence: MAG|GTRAGT where M is either A or C and R is either A or G. Splicing enzymes recognize the 3’ end of introns that have the following sequence: CAG|G. The | is the separation of the exon and the intron at both ends of the intron. Exons are bold, introns are not. This was determined experimentally using DNA so the bases are DNA. You need to change to RNA.
Provide the mature mRNA that results from the primary transcript of the wild-type allele when it undergoes splicing. Type it out so you do not make a mistake and I can read it.
Provide the mature mRNA that results from the primary transcript of the G to C allele when it undergoes splicing. Type it out so you do not make a mistake and I can read it.
Provide the mature mRNA that results from the primary transcript of the G allele when it undergoes splicing. Type it out so you do not make a mistake and I can read it.
Splicing is one modification that occurs to a primary transcript. Name and describe one other process that happens to primary transcripts to make them mature mRNAs.
Splicing and what you wrote in #14 above are two modifications that occur to a primary transcript. Name and describe one other process that happens to primary transcripts to make them mature mRNAs.
Translation.
You will be working with all three of the mature mRNA transcripts that you created above; wild-type (normal), G to C, and G. Type the polypeptide that results with the amino terminus at the left of the paper.
Provide the polypeptide that results from the mature mRNA of the wild-type allele. Type it out so you do not make a mistake and I can read it.
Provide the polypeptide that results from the mature mRNA of the G to C allele. Type it out so you do not make a mistake and I can read it.
Provide the polypeptide that results from the mature mRNA of the G allele. Type it out so you do not make a mistake and I can read it.
What functional chemical group is always found at the right of a polypeptide when written on this paper? What is its importance to the polypeptide?
Look at all three polypeptide chains. There should be some differences if you did this assignment correctly. Reflect on the importance of all of these enzymes working with high-fidelity (they do their job correctly without making mistakes).
Bonus.
This is not required. If you choose to do this and get it correct, I will add up to three bonus points to this assignment. Your score will not go above 20 points for this assignment.
Many proteins/enzymes in our cells are made up of multiple polypeptides (Quaternary structure) and are required to be this way to function correctly. An example is hemoglobin which has four polypeptides; two of the polypeptides are from one gene and two are from a different gene. They all come together correctly to allow us to transport oxygen from our lungs to the cells in our body so that the oxygen can be used to make ATP in cellular respiration.
Look at the wild-type and G polypeptide chains you created above. Assume that they are used in the cell to create an essential enzyme that allows a cell to live. We will call this enzyme Trouble. One of these polypeptides comes from a gene you inherited from your mother and the other comes from the gene you inherited from your father. After translation, two polypeptide chains come together in the cell to make the Trouble enzyme function.
Imagine what the outcome might be if you had both the wild-type and G alleles in your DNA at the same time; one from mom and one from dad. How many different types of Trouble enzyme could be created (base this on only the information given here)? Explain. What do you think the outcome for the cell would be? Explain.
2
The post Assignment 20 – Transcription and Translation Think of this as a cumulative appeared first on PapersSpot.