Get Writing Help
WhatsApp
   

Transcription, Translation and Protein Structure.


  Write My Assignment FREE
  1. (2pt. each) Transcription, Translation and Protein Structure.
  • True/False: Messenger RNA is transcribed by RNA polymerase II from a DNA template.
  • True/False: During transcription, mRNA is synthesized 5’à
  • True/False: As mRNA is synthesized, RNA nucleotides are added by base pairing with the complementary DNA strand; the sequence matches the coding (“top” or 5’) strand in the DNA double helix.
  • True/False: Messenger RNA is capped at the 3’ end, and a poly A tail added at the 5’ end, to make a mature mRNA.
  • True/False: mRNA is translated in the cytoplasm by ribosomes into a polypeptide chain.
  • True/False: Translation begins when a ribosome binds mRNA at the cap, scans down the mRNA nucleotides, and initiates when it reaches an AUG, encoding a Methionine (Met, M) amino acid.
  • True/False: Ribosomes are complex multi-subunit RNA and protein structures.
  • True/False: There are 20 amino acids, each encoded in mRNA by only one codon and by exactly one tRNA.
  • True/False: Mutations in a gene’s nucleotide (DNA) sequence always result in changes to the amino acids in a protein.
  • True/False: Alpha helix domains in the 3D protein structure of cyclin D1 are involved in interactions with CDK4 and DNA.
  • True/False: This algorithm will identify the start codon in a mRNA sequence: #My_Start_codon_finding_algorithm

>Read input (DNA) sequence 3 nt at a time

>If not AUG, go on to next 3 nt

>If AUG, print position in nucleotide sequence

>Advance +1 nt

>Repeat until no more sequence.

  • True/False: RT-PCR is a quantitative method for analyzing the amount of transcription of a specific gene.
  • True/False: A codon in a gene sequence encoding Threonine (Thr) is ACT. A mutation in the DNA changes the codon to ACG. The resulting protein structure will also change.
  • True/False: The degree of similarity between two DNA sequences can be analyzed by sequence alignment algorithms.
  • True/False: Translation takes place in the nucleus, while transcription takes place in the cytoplasm of the cell.
  • True/False: DNA replication occurs during S phase of the eukaryotic cell cycle.

 

 

  1. (20pts.) Transcription and Translation: Assume a transcriptional activator binds the DNA at the response element (RE: GGGAATTCCC) of the immune system gene IL2. mRNA transcription goes 5’à3’ from the CATATA a motif where RNA pol II can bind for transcription to proceed. It stops at a poly-A signal (AATAAA) sequence and adds several hundred A.

 

IL2 DNA:

AATGGGAATTCCCGATCATATATGATGGTCCTGCATAAGTTGGTCCGTTCAAGTATGCATAGAGCCGCCCATTACCAAGTACGCATAATGGACTGTAAGTAATAAAC

 

  • In the IL2 gene sequence, identify the response element (RE) where the transcriptional activator protein binds, the TATA motif where RNA pol II binds, and the poly-A signal sequence.

 

  • Transcribe the IL2 DNA sequence into RNA beginning at CATATA motif. Add locations of 5’ cap and 3’ poly-A tail (just write a few AAA…).

 

 

 

 

  • Find an ORF in the mRNA (identify the translation start and stop codons in the sequence).

 

  • Translate the ORF, this is the amino acid sequence of IL2 protein:

 

 

 

 

  • List the amino acids by group:
    1. Polar:
    2. Non-polar:
    3. (+) charge:
    4. (-) charge:

 

  • A patient with severe disease (a virus infection) has no functional IL2 protein. DNA sequencing shows the patient has a mutant IL2

 

Mutant IL2 DNA:

AATGGGAATTCCCGATCATATAGGAGGGTCCTGCATAAGTTGGTCCGTTCAAGTATGCATAGAGCCGCCCATTACCAAGTACGCATAATGGACTGTAAGTAATAAAC

 

Briefly explain why this patient does not synthesize IL2 protein, resulting in a compromised immune response to the virus:

 

 

Transcription, Translation and Protein Structure.

 

BIOLOGY A108 CQ 4

 

 

APA

 

 

 

CLICK HERE FOR FURTHER ASSISTANCE ON THIS ASSIGNMENT

The post Transcription, Translation and Protein Structure. appeared first on Apax Researchers.

Plagiarism Free Assignment Help

Expert Help With This Assignment — On Your Terms

Native UK, USA & Australia writers Deadline from 3 hours 100% Plagiarism-Free — Turnitin included Unlimited free revisions Free to submit — compare quotes
    Write My Assignment FREE     Get A Free Quote →
 
Limited Offer     Get 25% off your first order — use code STUDYLINK25 at checkout    Claim Now
 
Don`t copy text!